Sponge Barcoding Database: Specimen List

Growth form	Flabellate, planar, stipitate, to occ. Cup-shaped, symmetrical.
Color alive	Pale orange alive, grey-brown preserved..
Oscules	Large pores on face of fan, esp. near base.
Texture	Firm, barely compressible.
Surface ornamentation	Microscopically micropapillose, prominent stellate subdermal striations, grooved.
Choanosomal skeleton	Dense, confused reticulation of oxeas (robust), little spongin fibre but mod. heavy fibrillar collagen between spicules in mesohyl, choan. oxeas confined but subect. styles form ascending plumose tracts.
Ectosomal skeleton	No real ect. organization although ect. oxeas abundant in bunches, long subect. styles protrude through surface.
Megascleres	Choan. Oxeas (176-275 x 4-11um), subect. styles long, sinous ofr curved (478-830 x 2.5-5 um), ect. oxeas (108-164 x 1.5-3.5 um), echinating spicules absent.
Microscleres	nil.

Show/Hide	Sequence #554	28S	Genbank EU146415
Download sequence in FASTA format
CGTTGGGAGGGAACGAATGTGGCCATRAAGACTCCATTCAGGTTCAGGGAGACTCGGTTTGGGCGTTTGCGCGGTCGGGG ACCCGGTTTCGGGCCCCGCTGGCGCAAGTCCTTCCCGGSTCCTGNAAWCCCGTCTGGAGTYCSCCAAMGGCGGCCGTTTC CGGTCGAGGAGGGTCGTGGGGCAGGTTCCTCTTGGTYGACCCCTYYTGGGTTTGGCGAGGAGAGSTTACARCCTTGGGCT YGGTGGACCGGGGACGGCCGAGGAGSGTTGSGACCMRTCSCMCGGSGTAGSGCAGGCTCCGCAGGGGCCGGGTYGSTTYT GGAMTTGSGTGCTTCGCGGCGAGCCACTGCTCGCAGTGACCGCCGACGGTGGGTGCGCTTGTCTTGGAGACGGACCACGT TTGCGCTTCGGTCGTTGGTG

Record #604: Raspailia (Parasyringella) 2803